Display Settings:

Format

Send to:

Choose Destination
Pr012848616

STS probe DXS7076 for VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) (VMA21) and 3 more genes

Synopsis

Field NameValues
NameDXS7076
AliassWXD293
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesVMA21; VMA21; VMA21; LOC736390
UniSTS IDUniSTS:98932

Sequences

>Probe|12848616|PRIMERF Forward PCR primer (outermost) (19b)
ACAGAGCCTACCACATTCC
>Probe|12848616|PRIMERR Reverse PCR primer (outermost) (24b)
TTAGATACACTTACAGCATAGTCC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7076
Homo sapiensphysicalWUSTL-XX4.45 ordinalsWXD293

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID98932
Probe Cross-refcontext specific help for: Probe Cross-refGDB:452890
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk