Display Settings:

Format

Send to:

Choose Destination
Pr012846716

Homo sapiens STS probe RH102877 for transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) (TFAP2A)

Synopsis

Field NameValues
NameRH102877
AliasesstSG54574
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneTFAP2A (Homo sapiens)
UniSTS IDUniSTS:97211

Sequences

>Probe|12846716|PRIMERF Forward PCR primer (outermost) (22b)
TTAGTGGGTTTTGAATCTTCCC
>Probe|12846716|PRIMERR Reverse PCR primer (outermost) (20b)
TGTCCAGCTGTTTGTCACCT

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB4647.73 cr3000stSG54574
Homo sapienslinkageRutgers Map6 cmRH102877

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID97211
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk