Display Settings:

Format

Send to:

Choose Destination
Pr012842905

STS probe AL033905 for SET and MYND domain containing 3 (SMYD3) and 2 more genes

Synopsis

Field NameValues
NameAL033905
AliasstSG33370FS
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSMYD3; SMYD3; SMYD3
UniSTS IDUniSTS:93781

Sequences

>Probe|12842905|PRIMERF Forward PCR primer (outermost) (22b)
TTCCTCAAATTTGTTTTCCAGG
>Probe|12842905|PRIMERR Reverse PCR primer (outermost) (22b)
TAACCCAGTCAGACAAAAAGGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmAL033905

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID93781
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk