Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012842284

Eukaryota (6 taxa) STS probe AL032612 for MCF.2 cell line derived transforming sequence (MCF2) and 5 more genes

Synopsis

Field NameValues
NameAL032612
AliasesDJ1091A21SP6A; STSG52872
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesMCF2 (Callithrix jacchus); MCF2 (Pongo abelii); MCF2 (Nomascus leucogenys); MCF2 (Homo sapiens); MCF2 (Pan troglodytes); MCF2 (Macaca mulatta)

Sequences

>Probe|12842284|PRIMERF Forward PCR primer (outermost) (20b)
ACATGGACACAAGCTTGCAG
>Probe|12842284|PRIMERR Reverse PCR primer (outermost) (20b)
ATGCATTTTGAAGGTCCTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL032612

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID93221
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk