Display Settings:

Format

Send to:

Choose Destination
Pr012842259

Eukaryota (4 taxa) STS probe D9S2004 for family with sequence similarity 189, member A2 (FAM189A2) and 3 more genes

Synopsis

Field NameValues
NameD9S2004
AliasesEST125770; WI-10137
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesFAM189A2 (Pongo abelii); FAM189A2 (Nomascus leucogenys); FAM189A2 (Pan troglodytes); FAM189A2 (Homo sapiens)
UniSTS IDUniSTS:932

Sequences

>Probe|12842259|PRIMERF Forward PCR primer (outermost) (25b)
AAACATGTTTATTCTCAGTTCTGCC
>Probe|12842259|PRIMERR Reverse PCR primer (outermost) (18b)
ACTGCTCTGCGATTTGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmD9S2004

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID932
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678669
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk