Display Settings:

Format

Send to:

Choose Destination
Pr012841081

STS probe RH79783 for TPX2, microtubule-associated (TPX2) and 1 more gene

Synopsis

Field NameValues
NameRH79783
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTPX2; TPX2
UniSTS IDUniSTS:92133

Sequences

>Probe|12841081|PRIMERF Forward PCR primer (outermost) (20b)
TTAAAATGCACACTGCACGG
>Probe|12841081|PRIMERR Reverse PCR primer (outermost) (20b)
TGAGGAAGAAGACTGCGTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmRH79783

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID92133
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk