Display Settings:

Format

Send to:

Choose Destination
Pr012840989

STS probe AFM198zh6 for SH3 domain and tetratricopeptide repeats 2 (SH3TC2)

Synopsis

Field NameValues
NameAFM198zh6
AliasesRH96336; SHGC-878
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneSH3TC2
UniSTS IDUniSTS:92050

Sequences

>Probe|12840989|PRIMERF Forward PCR primer (outermost) (20b)
TGTGGGTATCTGGAGAAGTG
>Probe|12840989|PRIMERR Reverse PCR primer (outermost) (20b)
CACCAAGTCATGTCCTCACT

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG568908 cr50000SHGC-878
Homo sapienslinkageRutgers Map5 cmAFM198zh6

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID92050
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk