Display Settings:

Format

Send to:

Choose Destination
Pr012839915

STS probe D22S980E.1 for suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) (ST13) and 2 more genes

Synopsis

Field NameValues
NameD22S980E.1
AliasesD22S980E; RH11367; stSG2896
TypeSTS
Application
Source organism
Source sequence
Target genesLOC459811; ST13; ST13
UniSTS IDUniSTS:91081

Sequences

>Probe|12839915|PRIMERF Forward PCR primer (outermost) (18b)
TCGGTTCCCCTCTGTGTG
>Probe|12839915|PRIMERR Reverse PCR primer (outermost) (22b)
TTCCCTTTGGTGTTTGGTCTTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:441450
UniSTS IDcontext specific help for: UniSTS ID91081
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk