Display Settings:

Format

Send to:

Choose Destination
Pr012839231

Homo sapiens and Nomascus leucogenys STS probe RH98963 for inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E) and 1 more gene

Synopsis

Field NameValues
NameRH98963
AliasesstSG51000
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Homo sapiens
Target genesINPP5E (Nomascus leucogenys); INPP5E (Homo sapiens)
UniSTS IDUniSTS:90464

Sequences

>Probe|12839231|PRIMERF Forward PCR primer (outermost) (22b)
TACTCTCGAAGAAAGAAACCCG
>Probe|12839231|PRIMERR Reverse PCR primer (outermost) (18b)
TCTTTAACTCCAGCCGCG

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB49417.72 cr3000stSG51000
Homo sapienslinkageRutgers Map9 cmRH98963

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID90464
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk