Display Settings:

Format

Send to:

Choose Destination
Pr012838685

STS probe RH65166 for E2F transcription factor 6 (E2F6) and 3 more genes

Synopsis

Field NameValues
NameRH65166
AliasstSG21594
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesE2F6; E2F6; E2F6; E2F6
UniSTS IDUniSTS:89972

Sequences

>Probe|12838685|PRIMERF Forward PCR primer (outermost) (20b)
GTCCCTCAAGGAGCTCACAG
>Probe|12838685|PRIMERR Reverse PCR primer (outermost) (20b)
GTATGCAGCCTTGCTGTTGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmRH65166

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID89972
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk