Display Settings:

Format

Send to:

Choose Destination
Pr012838473

STS probe RH75844 for lymphotoxin beta (LTB) and 13 more genes

Synopsis

Field NameValues
NameRH75844
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100289233; LOC100290815; LOC100292000; LOC100294154; LOC100294183; LOC100294218; LOC100294268; LOC100294309; LOC100427232; LTB; LTB; LTB; LTB; LTB
UniSTS IDUniSTS:89779

Sequences

>Probe|12838473|PRIMERF Forward PCR primer (outermost) (20b)
GGTGAGGGAATATGAGTGCG
>Probe|12838473|PRIMERR Reverse PCR primer (outermost) (20b)
TTTATCGGCAGCACTGAAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmRH75844

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID89779
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk