Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012836826

Pongo abelii and Homo sapiens STS probe RH79754 for acyl-CoA synthetase family member 3 (ACSF3) and 1 more gene

Synopsis

Field NameValues
NameRH79754
TypeSTS
Application
Source organism
Source sequence
Target organismsPongo abelii; Homo sapiens
Target genesLOC100459467 (Pongo abelii); ACSF3 (Homo sapiens)

Sequences

>Probe|12836826|PRIMERF Forward PCR primer (outermost) (18b)
GAAGCCTTTTGGGCCTGC
>Probe|12836826|PRIMERR Reverse PCR primer (outermost) (21b)
CACAAATTGCCAAGACTGACG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmRH79754

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID88293
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk