Display Settings:

Format

Send to:

Choose Destination
Pr012836781

STS probe UniSTS:88252 for mitochondrial ribosomal protein L48 (MRPL48) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:88252
AliasesD6S351E.1; D6S351E; RH37248; stSG6620
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMRPL48; MRPL48
UniSTS IDUniSTS:88252

Sequences

>Probe|12836781|PRIMERF Forward PCR primer (outermost) (20b)
GAACTGGAAGAACTGTTGGC
>Probe|12836781|PRIMERR Reverse PCR primer (outermost) (20b)
AATCTAAGGGTTGGGTCTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmUniSTS:88252

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID88252
Probe Cross-refcontext specific help for: Probe Cross-refGDB:193156
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk