Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012836433

Eukaryota (5 taxa) STS probe Cda0fb12 for stereocilin (STRC) and 10 more genes

Synopsis

Field NameValues
NameCda0fb12
AliasesD15S609E; RH17350
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100134280 (Homo sapiens); LOC100434832 (Pongo abelii); LOC100436701 (Pongo abelii); LOC100507967 (Homo sapiens); STRC (Nomascus leucogenys); STRC (Homo sapiens); STRC (Pan troglodytes); STRCP1 (Homo sapiens); LOC652517 (Homo sapiens); STRC (Macaca mulatta); LOC742658 (Pan troglodytes)

Sequences

>Probe|12836433|PRIMERF Forward PCR primer (outermost) (22b)
CTGGTCACAGAACCAAGATATG
>Probe|12836433|PRIMERR Reverse PCR primer (outermost) (21b)
AGTGTGGGGTAGTAGTTGAAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:364439
UniSTS IDcontext specific help for: UniSTS ID87939
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk