Display Settings:

Format

Send to:

Choose Destination
Pr012836184

STS probe UniSTS:87712 for SEC14-like 2 (S. cerevisiae) (SEC14L2) and 5 more genes

Synopsis

Field NameValues
NameUniSTS:87712
AliasesD22S1023E.1; D22S1023E; RH11364; stSG2892
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100451194; SEC14L2; SEC14L2; SEC14L2; LOC715793; SEC14L2
UniSTS IDUniSTS:87712

Sequences

>Probe|12836184|PRIMERF Forward PCR primer (outermost) (21b)
CTCCCTGTCAATTTCTACCCC
>Probe|12836184|PRIMERR Reverse PCR primer (outermost) (18b)
AGTCGCTCTTCCTCTGCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmUniSTS:87712

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID87712
Probe Cross-refcontext specific help for: Probe Cross-refGDB:441594
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk