Display Settings:

Format

Send to:

Choose Destination
Pr012835718

STS probe D15S1324 for neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase (NEDD4) and 4 more genes

Synopsis

Field NameValues
NameD15S1324
AliasesRH7801; SHGC-10979
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100456436; NEDD4; NEDD4; NEDD4; NEDD4
UniSTS IDUniSTS:8729

Sequences

>Probe|12835718|PRIMERF Forward PCR primer (outermost) (20b)
ACCACCACACCTGGCTTTAG
>Probe|12835718|PRIMERR Reverse PCR primer (outermost) (20b)
AGAAAAAACTGCCTGGCAGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3151640 cr10000SHGC-10979
Homo sapiensradiation hybridGeneMap99-G3151640 cr10000SHGC-10979
Homo sapienslinkageRutgers Map15 cmD15S1324

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID8729
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737905; GDB:738792
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk