Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012834754

Eukaryota (5 taxa) STS probe SHGC-12710 for mucin 1, cell surface associated (MUC1) and 5 more genes

Synopsis

Field NameValues
NameSHGC-12710
AliasesRH9044
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100291124 (Homo sapiens); MUC1 (Pongo abelii); MUC1 (Nomascus leucogenys); MUC1 (Homo sapiens); LOC717546 (Macaca mulatta); MUC1 (Pan troglodytes)

Sequences

>Probe|12834754|PRIMERF Forward PCR primer (outermost) (20b)
CACCCCAGTTTTTGCAGATT
>Probe|12834754|PRIMERR Reverse PCR primer (outermost) (24b)
AGATCGTCAGGTTATATCGAGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmSHGC-12710

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID86418
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk