Display Settings:

Format

Send to:

Choose Destination
Pr012834531

STS probe RH65260 for epithelial membrane protein 2 (EMP2)

Synopsis

Field NameValues
NameRH65260
AliasstSG26893
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneEMP2
UniSTS IDUniSTS:86217

Sequences

>Probe|12834531|PRIMERF Forward PCR primer (outermost) (20b)
CAACATTCAGTGCCCACATC
>Probe|12834531|PRIMERR Reverse PCR primer (outermost) (21b)
GAAGCTTGGATGTTTTCTCCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmRH65260

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID86217
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk