Display Settings:

Format

Send to:

Choose Destination
Pr012834299

STS probe RH75687 for methylmalonyl-CoA mutase (MUT) and 4 more genes

Synopsis

Field NameValues
NameRH75687
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMUT; LOC100505950; MUT; MUT; MUT
UniSTS IDUniSTS:86007

Sequences

>Probe|12834299|PRIMERF Forward PCR primer (outermost) (21b)
ATTCTGGGGAACATGTGCAGG
>Probe|12834299|PRIMERR Reverse PCR primer (outermost) (24b)
GGTGATGTCAACTGTGAGTGTAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmRH75687

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID86007
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk