Display Settings:

Format

Send to:

Choose Destination
Pr012834206

STS probe RH25845 for beta 3-glucosyltransferase (B3GLCT) and 2 more genes

Synopsis

Field NameValues
NameRH25845
AliasA006N04
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesB3GALTL; B3GLCT; B3GLCT
UniSTS IDUniSTS:85923

Sequences

>Probe|12834206|PRIMERF Forward PCR primer (outermost) (23b)
ATGTGACTGTCTACAGTTCTATT
>Probe|12834206|PRIMERR Reverse PCR primer (outermost) (23b)
CAGTATTATTCCTTAATACGGTA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map13 cmRH25845

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID85923
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk