Display Settings:

Format

Send to:

Choose Destination
Pr012832770

STS probe RH11229 for thyrotrophic embryonic factor (TEF) and 1 more gene

Synopsis

Field NameValues
NameRH11229
AliasesstSG2338
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTEF; TEF
UniSTS IDUniSTS:84621

Sequences

>Probe|12832770|PRIMERF Forward PCR primer (outermost) (20b)
ACCAGCAAGTGACACACTCG
>Probe|12832770|PRIMERR Reverse PCR primer (outermost) (20b)
GGCCCCTCTCTTTACCTTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmRH11229

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID84621
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk