Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012831889

Eukaryota (5 taxa) STS probe RH92545 for beta 1,3-galactosyltransferase-like (B3GALTL) and 4 more genes

Synopsis

Field NameValues
NameRH92545
AliasesstSG47273
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesB3GALTL (Pongo abelii); B3GALTL (Nomascus leucogenys); B3GALTL (Homo sapiens); B3GALTL (Pan troglodytes); LOC713498 (Macaca mulatta)

Sequences

>Probe|12831889|PRIMERF Forward PCR primer (outermost) (21b)
AAATGTTTCTCCTGTGACCCC
>Probe|12831889|PRIMERR Reverse PCR primer (outermost) (20b)
ATGAACTGGAGACTGTGGCC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41395 cr3000stSG47273
Homo sapienslinkageRutgers Map13 cmRH92545

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID83826
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk