Display Settings:

Format

Send to:

Choose Destination
Pr012831423

Pan troglodytes and Homo sapiens STS probe humtcajc for T cell receptor alpha locus (TRA) and 4 more genes

Synopsis

Field NameValues
Namehumtcajc
AliasesRH11152
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesTRAJ17 (Homo sapiens); TRAJ3 (Homo sapiens); TRAJ2 (Homo sapiens); LOC452781 (Pan troglodytes); TRA (Homo sapiens)
UniSTS IDUniSTS:834

Sequences

>Probe|12831423|PRIMERF Forward PCR primer (outermost) (22b)
AAACACAGAAGTGCCAAGAGCC
>Probe|12831423|PRIMERR Reverse PCR primer (outermost) (22b)
AGAGTAGAGCCCAGATTTTCCC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41414.11 cr3000humtcajc
Homo sapienslinkageRutgers Map14 cmhumtcajc

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID834
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk