Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012831213

Eukaryota (3 taxa) STS probe WI-8558 for filamin A interacting protein 1-like (FILIP1L) and 7 more genes

Synopsis

Field NameValues
NameWI-8558
AliasesEST91731
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Homo sapiens
Target genesLOC100130401 (Homo sapiens); FILIP1L (Nomascus leucogenys); CMSS1 (Nomascus leucogenys); FILIP1L (Homo sapiens); FILIP1L (Pan troglodytes); LOC643328 (Homo sapiens); LOC647872 (Homo sapiens); CMSS1 (Homo sapiens)

Sequences

>Probe|12831213|PRIMERF Forward PCR primer (outermost) (21b)
TTTTGTGGTTATTGGCAGAGG
>Probe|12831213|PRIMERR Reverse PCR primer (outermost) (21b)
TGAACAGACCCATCATATGCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmWI-8558

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID83206
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk