Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012831085

Homo sapiens STS probe D4S3213

Synopsis

Field NameValues
NameD4S3213
AliasesMR10929; RH42862; RH43267; RH59256; RH6052; SHGC-24974; WI-5661
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12831085|PRIMERF Forward PCR primer (outermost) (25b)
TTTTGAGGAAGTCACTCATTAGACA
>Probe|12831085|PRIMERR Reverse PCR primer (outermost) (23b)
TAGGATTACAAAGGCAAGTTTGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G349567 cr10000SHGC-24974
Homo sapienslinkageRutgers Map4 cmD4S3213
Homo sapiensradiation hybridNCBI RH41765.6 crSHGC-24974
Homo sapiensradiation hybridWhitehead-RH4741.1 cr3000WI-5661

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID83088
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678697
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk