Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012831041

Eukaryota (3 taxa) STS probe D3S4183 for activated leukocyte cell adhesion molecule (ALCAM) and 2 more genes

Synopsis

Field NameValues
NameD3S4183
AliasesRH8679; SHGC-11693
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Homo sapiens
Target genesALCAM (Nomascus leucogenys); ALCAM (Homo sapiens); ALCAM (Pan troglodytes)

Sequences

>Probe|12831041|PRIMERF Forward PCR primer (outermost) (23b)
TTTTCTTCTTAGCATCTTCGTGC
>Probe|12831041|PRIMERR Reverse PCR primer (outermost) (20b)
ACTCAGAGCTCTGGACCGAA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G334652 cr10000SHGC-11693
Homo sapiensradiation hybridGeneMap99-G335122 cr10000SHGC-11693
Homo sapienslinkageRutgers Map3 cmD3S4183
Homo sapiensradiation hybridNCBI RH3844.9 crSHGC-11693

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID83048
Probe Cross-refcontext specific help for: Probe Cross-refGDB:733921; GDB:735689
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk