Display Settings:

Format

Send to:

Choose Destination
Pr012830569

STS probe A006V32 for zinc finger protein 83 (ZNF83) and 1 more gene

Synopsis

Field NameValues
NameA006V32
AliasesRH26087
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC456265; ZNF83
UniSTS IDUniSTS:82620

Sequences

>Probe|12830569|PRIMERF Forward PCR primer (outermost) (23b)
TTTGTGTAGTTACTCTCCAGTAT
>Probe|12830569|PRIMERR Reverse PCR primer (outermost) (22b)
ATCAGAGAATCCATACTAAAGA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419277.76 cr3000A006V32
Homo sapienslinkageRutgers Map19 cmA006V32
Homo sapiensradiation hybridNCBI RH19576.1 crA006V32

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID82620
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk