Display Settings:

Format

Send to:

Choose Destination
Pr012830205

STS probe SHGC-12848 for serine/arginine-rich splicing factor 2 (SRSF2)

Synopsis

Field NameValues
NameSHGC-12848
AliasesRH14079; SFRS2; UTR-03818; WI-7837
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneSRSF2
UniSTS IDUniSTS:8229

Sequences

>Probe|12830205|PRIMERF Forward PCR primer (outermost) (24b)
ACATAGTCCATCGAAGAAGAGTCC
>Probe|12830205|PRIMERR Reverse PCR primer (outermost) (23b)
TCAATCTCTTGACAGCTTTAGGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3173328 cr10000SHGC-12848
Homo sapiensradiation hybridGeneMap99-G3173829 cr10000SHGC-12848
Homo sapienslinkageRutgers Map17 cmSHGC-12848
Homo sapiensradiation hybridNCBI RH17795 crSHGC-12848

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID8229
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677701
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk