Display Settings:

Format

Send to:

Choose Destination
Pr012829687

Macaca mulatta and Homo sapiens STS probe D9S934

Synopsis

Field NameValues
NameD9S934
AliasesCHLC.GATA64G07; CHLC.GATA64G07.P17882; GATA-D9S934; GATA64G07; RH28123; RH30540; RH62689; RH7380; RH95684; SHGC-18078
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Homo sapiens
UniSTS IDUniSTS:81816

Sequences

>Probe|12829687|PRIMERF Forward PCR primer (outermost) (25b)
TTTCCTAGTAGCTCAAGTAAAGAGG
>Probe|12829687|PRIMERR Reverse PCR primer (outermost) (23b)
AGACTTGGACTGAATTACACTGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A rhesus macaque radiation hybrid map and comparative analysis with the human genome.

Murphy WJ, Agarwala R, Schäffer AA, Stephens R, Smith C Jr, Crumpler NJ, David VA, O'Brien SJ.

Genomics. 2005 Oct;86(4):383-95.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

5.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

6.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G394139 cr10000SHGC-18078
Homo sapiensradiation hybridTNG939025 cr50000SHGC-18078
Homo sapienslinkageRutgers Map9 cmD9S934
Macaca mulattaradiation hybridRH15363.4 crD9S934
Homo sapienslinkageMarshfield9127.98 cmGATA64G07
Homo sapiensradiation hybridNCBI RH91108.2 crSHGC-18078
Homo sapiensradiation hybridWhitehead-RH9440.7 cr3000CHLC.GATA64G07

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID81816
Probe Cross-refcontext specific help for: Probe Cross-refGDB:685365
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk