Display Settings:

Format

Send to:

Choose Destination
Pr012829327

Homo sapiens STS probe D2S336

Synopsis

Field NameValues
NameD2S336
Aliases275YF5; AFM275yf5; HS275YF5; RH15378; RH84269; SHGC-69229
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:81486

Sequences

>Probe|12829327|PRIMERF Forward PCR primer (outermost) (25b)
TTTATTTAGTTACAGACTTTGCTTC
>Probe|12829327|PRIMERR Reverse PCR primer (outermost) (16b)
GTCACAGGGCACTTGG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S336
Homo sapienslinkageMarshfield2245.44 cmAFM275yf5
Homo sapienslinkageGenethon2253 cmAFM275yf5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID81486
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199684
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk