Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012828877

Eukaryota (8 taxa) STS probe WI-14803 for echinoderm microtubule associated protein like 4 (EML4) and 8 more genes

Synopsis

Field NameValues
NameWI-14803
AliasesEST266543; RH56279
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Nomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Sus scrofa
Target genesLOC100388393 (Callithrix jacchus); LOC100424618 (Macaca mulatta); EML4 (Pongo abelii); EML4 (Sus scrofa); EML4 (Nomascus leucogenys); EML4 (Homo sapiens); EML4 (Pan troglodytes); EML4 (Macaca mulatta); Eml4 (Mus musculus)

Sequences

>Probe|12828877|PRIMERF Forward PCR primer (outermost) (24b)
TTTAATCTTCAAAATTTTCTGCCA
>Probe|12828877|PRIMERR Reverse PCR primer (outermost) (25b)
AAAACTTGTGAATGAAAATGAATCC

References

1.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB42134.49 cr3000WI-14803
Homo sapienslinkageRutgers Map2 cmWI-14803
Homo sapiensradiation hybridWhitehead-RH2196.3 cr3000WI-14803

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID81072
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk