Display Settings:

Format

Send to:

Choose Destination
Pr012828496

STS probe G15976 for glutathione S-transferase mu 5 (GSTM5) and 2 more genes

Synopsis

Field NameValues
NameG15976
AliasesCHLC.UTR_05185_L02321; CHLC.UTR_05185_L02321.P65600
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100426406; GSTM5; GSTM5
UniSTS IDUniSTS:80727

Sequences

>Probe|12828496|PRIMERF Forward PCR primer (outermost) (20b)
TTGTGGGTGGTTTTTTGTCT
>Probe|12828496|PRIMERR Reverse PCR primer (outermost) (20b)
CCAGTTCTAGACGGCCTACA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmG15976

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID80727
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk