Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012828166

Eukaryota (4 taxa) STS probe D11S4398 for murine retrovirus integration site 1 homolog (MRVI1) and 3 more genes

Synopsis

Field NameValues
NameD11S4398
AliasesMR12349; RH3011; RH51834; WI-9774
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesMRVI1 (Pongo abelii); MRVI1 (Nomascus leucogenys); MRVI1 (Homo sapiens); MRVI1 (Pan troglodytes)

Sequences

>Probe|12828166|PRIMERF Forward PCR primer (outermost) (25b)
TTGGTGAGACTTCTTTCTATTCACA
>Probe|12828166|PRIMERR Reverse PCR primer (outermost) (23b)
TACGGGCCTACAGTACACTTAGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmD11S4398
Homo sapiensradiation hybridNCBI RH1130.6 crWI-9774
Homo sapiensradiation hybridWhitehead-RH1148.8 cr3000WI-9774

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID80428
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678453
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk