Display Settings:

Format

Send to:

Choose Destination
Pr012828141

STS probe D7S632 for family with sequence similarity 188, member B (FAM188B) and 1 more gene

Synopsis

Field NameValues
NameD7S632
AliasesAFM198ze5; RH1096; SHGC-1882
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFAM188B; FAM188B
UniSTS IDUniSTS:80405

Sequences

>Probe|12828141|PRIMERF Forward PCR primer (outermost) (20b)
TTGGTAGGTCAGAAGCACAT
>Probe|12828141|PRIMERR Reverse PCR primer (outermost) (20b)
CTGAAGTCAGGTGTGCCAAT

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G371279 cr10000AFM198ze5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID80405
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk