Display Settings:

Format

Send to:

Choose Destination
Pr012827604

STS probe D15S613E for small nuclear ribonucleoprotein polypeptide N (SNRPN) and 1 more gene

Synopsis

Field NameValues
NameD15S613E
AliasesCda0jb12; RH10022
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSNRPN; LOC744573
UniSTS IDUniSTS:79917

Sequences

>Probe|12827604|PRIMERF Forward PCR primer (outermost) (21b)
TTGCCTGACTTCACAGAGTAG
>Probe|12827604|PRIMERR Reverse PCR primer (outermost) (19b)
CAGAGGGGGTGACTGTTTC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41535.47 cr3000Cda0jb12
Homo sapienslinkageRutgers Map15 cmD15S613E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID79917
Probe Cross-refcontext specific help for: Probe Cross-refGDB:364451; GDB:364540
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk