Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012827418

Homo sapiens STS probe D16S3299

Synopsis

Field NameValues
NameD16S3299
AliasesRH35226; SHGC-8819
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12827418|PRIMERF Forward PCR primer (outermost) (21b)
TTGCAATGATATCCGTAAGGC
>Probe|12827418|PRIMERR Reverse PCR primer (outermost) (21b)
TCTTCTTTCTGCTGCGTGTTT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G316450 cr10000SHGC-8819
Homo sapienslinkageRutgers Map16 cmD16S3299
Homo sapiensradiation hybridNCBI RH1697.3 crSHGC-8819

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID79749
Probe Cross-refcontext specific help for: Probe Cross-refGDB:736416
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk