Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012827186

Eukaryota (5 taxa) STS probe D2S2694 for TSEN34 tRNA splicing endonuclease subunit (TSEN34) and 7 more genes

Synopsis

Field NameValues
NameD2S2694
AliasesEST125771; RH55826; WI-10138
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesTSEN34 (Callithrix jacchus); RPS9 (Pongo abelii); TSEN34 (Pongo abelii); TSEN34 (Nomascus leucogenys); RPS9 (Nomascus leucogenys); TSEN34 (Pan troglodytes); RPS9 (Pan troglodytes); TSEN34 (Homo sapiens)

Sequences

>Probe|12827186|PRIMERF Forward PCR primer (outermost) (24b)
TTGAGACCTCCTGAGACTTAAACC
>Probe|12827186|PRIMERR Reverse PCR primer (outermost) (21b)
CTGCAGTGAACTCCAGAGACC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419289.61 cr3000WI-10138
Homo sapienslinkageRutgers Map19 cmD2S2694

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID79539
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678676
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk