Display Settings:

Format

Send to:

Choose Destination
Pr012825808

STS probe D1S2493 for neuroblastoma breakpoint family member 9-like (LOC100435701) and 1 more gene

Synopsis

Field NameValues
NameD1S2493
AliasesMR10935; WI-5663; stD1S2493
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100435701; LOC100583376
UniSTS IDUniSTS:78281

Sequences

>Probe|12825808|PRIMERF Forward PCR primer (outermost) (21b)
TTCCAGTTGTCTTGAACAGCC
>Probe|12825808|PRIMERR Reverse PCR primer (outermost) (19b)
TAATGGCCACTTGGAGCAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:589390
UniSTS IDcontext specific help for: UniSTS ID78281
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk