Display Settings:

Format

Send to:

Choose Destination
Pr012825705

STS probe D17S2008 for nucleoredoxin (NXN) and 1 more gene

Synopsis

Field NameValues
NameD17S2008
AliasesMR15024; RH4251; RH55184; WI-10854; WIAF-408; WIAF-409
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNXN; NXN
UniSTS IDUniSTS:78189

Sequences

>Probe|12825705|PRIMERF Forward PCR primer (outermost) (20b)
TTCCACAAAAACTTCCCTGG
>Probe|12825705|PRIMERR Reverse PCR primer (outermost) (20b)
CAACACAGCAGACCCTGTGT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S2008
Homo sapiensradiation hybridNCBI RH1740.3 crWI-10854
Homo sapiensradiation hybridWhitehead-RH1724 cr3000WI-10854

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID78189
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678091
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk