Display Settings:

Format

Send to:

Choose Destination
Pr012825144

STS probe M89913 for deoxyuridine triphosphatase (DUT) and 2 more genes

Synopsis

Field NameValues
NameM89913
AliasesSTSG-9875; UTR-9875
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100130218; DUT; DUT
UniSTS IDUniSTS:77682

Sequences

>Probe|12825144|PRIMERF Forward PCR primer (outermost) (22b)
TTCAAGTGTTTTGGTGTTTTGC
>Probe|12825144|PRIMERR Reverse PCR primer (outermost) (22b)
TTTCATACAACCTTCAATTGCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmM89913

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77682
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk