Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012825132

Nomascus leucogenys STS probe G11813 for chromosome 1a open reading frame, human C6orf1 (C1AH6orf1) and 1 more gene

Synopsis

Field NameValues
NameG11813
AliasesEST102760; WI-8655
TypeSTS
Application
Source organism
Source sequence
Target organismNomascus leucogenys
Target genesC1AH6orf1 (Nomascus leucogenys); LOC100607654 (Nomascus leucogenys)

Sequences

>Probe|12825132|PRIMERF Forward PCR primer (outermost) (25b)
TTCAAGTAACTGCAAATAGGAAACC
>Probe|12825132|PRIMERR Reverse PCR primer (outermost) (20b)
ATAAAGGGTGTAGGGGCCAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77671
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk