Display Settings:

Format

Send to:

Choose Destination
Pr012824671

Eukaryota (3 taxa) STS probe A009J17 for SHC (Src homology 2 domain containing) transforming protein 3 (SHC3) and 2 more genes

Synopsis

Field NameValues
NameA009J17
AliasesRH67270
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesSHC3 (Pongo abelii); SHC3 (Pan troglodytes); SHC3 (Homo sapiens)
UniSTS IDUniSTS:77247

Sequences

>Probe|12824671|PRIMERF Forward PCR primer (outermost) (20b)
TTATGAAACTTGACCTTAAA
>Probe|12824671|PRIMERR Reverse PCR primer (outermost) (18b)
CGGAGTGGACCTAGAATC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB49297.91 cr3000A009J17
Homo sapienslinkageRutgers Map9 cmA009J17

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77247
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk