Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012824502

Homo sapiens and Nomascus leucogenys STS probe RH46612 for butyrophilin, subfamily 2, member A1 (BTN2A1) and 1 more gene

Synopsis

Field NameValues
NameRH46612
AliasesstSG24641
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Homo sapiens
Target genesBTN2A1 (Nomascus leucogenys); BTN2A1 (Homo sapiens)

Sequences

>Probe|12824502|PRIMERF Forward PCR primer (outermost) (22b)
TTAGTTTCAATCTCAAATGCCA
>Probe|12824502|PRIMERR Reverse PCR primer (outermost) (21b)
GCTTCAAACTTCCTGGTTTCA

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB46105.39 cr3000stSG24641
Homo sapienslinkageRutgers Map6 cmRH46612

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77093
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk