Display Settings:

Format

Send to:

Choose Destination
Pr012824298

STS probe D7S2484 for caspase recruitment domain family, member 11 (CARD11) and 4 more genes

Synopsis

Field NameValues
NameD7S2484
AliasesAFMb286yc5; sWSS2500
TypeSTS
Application
Source organism
Source sequence
Target genesCARD11; CARD11; CARD11; CARD11; CARD11
UniSTS IDUniSTS:76907

Sequences

>Probe|12824298|PRIMERF Forward PCR primer (outermost) (18b)
TTAGAGTCCAGATGTTCC
>Probe|12824298|PRIMERR Reverse PCR primer (outermost) (22b)
AGAGCCTAGAATTTTATTACCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3754555
UniSTS IDcontext specific help for: UniSTS ID76907
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk