Display Settings:

Format

Send to:

Choose Destination
Pr012823189

STS probe D17S793 for trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) (TVP23C) and 1 more gene

Synopsis

Field NameValues
NameD17S793
Aliases165zd4; 165zd4A; AFM165zd4; RH4166; RH54902
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCDRT4; TVP23C
UniSTS IDUniSTS:75899

Sequences

>Probe|12823189|PRIMERF Forward PCR primer (outermost) (20b)
TGTTGGAGTTAATGTGCCAT
>Probe|12823189|PRIMERR Reverse PCR primer (outermost) (20b)
TCTTTGACCCAGACCTCTAA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield1741.12 cm165zd4A
Homo sapienslinkageMarshfield1747 cm165zd4
Homo sapiensradiation hybridNCBI RH17279 crD17S793
Homo sapiensradiation hybridWhitehead-RH17134.8 cr3000D17S793

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188160
UniSTS IDcontext specific help for: UniSTS ID75899
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk