Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012823072

Eukaryota (3 taxa) STS probe D2S2648 for titin (TTN) and 4 more genes

Synopsis

Field NameValues
NameD2S2648
AliasesUTR-04332; WI-9271
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesTTN (Pongo abelii); TTN-AS1 (Homo sapiens); LOC100508682 (Homo sapiens); TTN (Pan troglodytes); TTN (Homo sapiens)

Sequences

>Probe|12823072|PRIMERF Forward PCR primer (outermost) (20b)
TGTTCGCTCATTTTACGCTG
>Probe|12823072|PRIMERR Reverse PCR primer (outermost) (25b)
TCTGGCATAGGAATACTTGAATAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S2648

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID75793
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678206
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk