Display Settings:

Format

Send to:

Choose Destination
Pr012822869

STS probe D10S2290 for enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1) and 4 more genes

Synopsis

Field NameValues
NameD10S2290
AliasesRH13978; SHGC-12553; UTR-04466; WI-7317
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesECHS1; ECHS1; FUOM; ECHS1; ECHS1
UniSTS IDUniSTS:7561

Sequences

>Probe|12822869|PRIMERF Forward PCR primer (outermost) (20b)
ACACCTCTGCTTGGAGAGGA
>Probe|12822869|PRIMERR Reverse PCR primer (outermost) (20b)
GCATCTGTATGAAGGCAGCA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3106267 cr10000SHGC-12553
Homo sapiensradiation hybridGeneMap99-G3106503 cr10000SHGC-12553
Homo sapienslinkageRutgers Map10 cmD10S2290
Homo sapiensradiation hybridNCBI RH101398.7 crSHGC-12553

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID7561
Probe Cross-refcontext specific help for: Probe Cross-refGDB:679121
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk