Display Settings:

Format

Send to:

Choose Destination
Pr012822556

Homo sapiens STS probe D20S557E for protein phosphatase 1, regulatory subunit 16B (PPP1R16B)

Synopsis

Field NameValues
NameD20S557E
AliasesRH12159; stSG3008
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePPP1R16B (Homo sapiens)
UniSTS IDUniSTS:75325

Sequences

>Probe|12822556|PRIMERF Forward PCR primer (outermost) (18b)
TGTGCCCCCTTTGGGATG
>Probe|12822556|PRIMERR Reverse PCR primer (outermost) (21b)
ACTGAGGTAACTTCCACGTAG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB420220.61 cr3000stSG3008
Homo sapienslinkageRutgers Map20 cmD20S557E
Homo sapiensradiation hybridNCBI RH20331.7 crstSG3008

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID75325
Probe Cross-refcontext specific help for: Probe Cross-refGDB:441195
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk