Display Settings:

Format

Send to:

Choose Destination
Pr012822215

STS probe D17S923 for ubiquitin specific peptidase 32 (USP32) and 5 more genes

Synopsis

Field NameValues
NameD17S923
AliasesAFM200va9; RH31776; SHGC-2238
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100294407; LOC100438940; LOC100510589; LOC650546; LOC731865; USP32
UniSTS IDUniSTS:75015

Sequences

>Probe|12822215|PRIMERF Forward PCR primer (outermost) (20b)
TGTCGATGATTGCATGTAGA
>Probe|12822215|PRIMERR Reverse PCR primer (outermost) (21b)
GTGCTTCTCTCTCTGTGTGTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3172550 cr10000SHGC-2238
Homo sapiensradiation hybridGeneMap99-G3173051 cr10000AFM200va9
Homo sapiensradiation hybridNCBI RH17663.6 crSHGC-2238

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID75015
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk