Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012821756

Homo sapiens STS probe D3S3650

Synopsis

Field NameValues
NameD3S3650
AliasesAFMB323YB1; AFMb323yb1; B323YB1; HSB323YB1; W6633
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12821756|PRIMERF Forward PCR primer (outermost) (20b)
TGTACTCTCATGAAGCAAGC
>Probe|12821756|PRIMERR Reverse PCR primer (outermost) (25b)
AATATTTAGGAGGGTGCTATAGACT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S3650
Homo sapienslinkageMarshfield3174.94 cmAFMb323yb1
Homo sapienslinkageGenethon3179.8 cmAFMb323yb1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID74601
Probe Cross-refcontext specific help for: Probe Cross-refGDB:611013
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk